SARS-COVID-19 ֹ *ʼ Ȯ*
plasmid-control-map-and-sequences.zip(799.9K)  [57]   2020-05-14 19:42:52
who-plasmid-control-map-and-sequences.zip(888.3K)  [5]   2020-05-14 19:42:52
ֱ SARS-COVID-19 · ǰ û ϰ ִ ȲԴϴ.
 
̿ SARS-COVID-19 Ե ǰ Ʒ stock شǴ ǰ ̻ custom Ұϸ,
غ stock ǰθ ֹ ˷帳ϴ. (Ʒ list Ȯ ٶϴ.)
Stock ǰ custom 帱 ִ ֽϴ. 
·  ε Ե Ź 帳ϴ.

COVID detection oligo 䰡 Կ IDT 籸 Ͽ ̰ COVID-19 ֹ ռϰ ˷帳ϴ. ̷ ֹ TAT ְ Ǿϴ. , 46 bases ̰ ƴ ٸ facility (US/ Belgium) ռ ǿ ȥ ñ ٶϴ. ̴ ְ ǰ 帮 IDT ħ̿ Ź 帳ϴ.


Ǵ koreacustcare@idtdna.com Ź 帳ϴ. մϴ.

<Stock ǰ > - ش list ÷ Ϸε ε Ͽϴ.
* Probe FAM/ZEN/IBFQ Դϴ.
* Individual primers and probes, HPLC purified, and delivered in IDTE (1X TE buffer) pH 7.5 at 100µM. Available in normalized deliverables to the amounts indicated below and shipped ambient.
* Ʒ stock ǰ Functional Test (NTC ), HPLC purification Template control process GMPü Ǿϴ.
* Control plasmids contain the complete envelope gene and a portion of the RNA-dependent RNA polymerase (RdRP) from 2019-nCoV. The 2019-nCoV Charité/Berlin qPCR Probe Assays target regions within the nCoV envelope gene and the RdRP gene which are present in the 2019-nCoV_E Positive Control and 2019-nCoV_RdRP positive control plasmids. Delivered at 250µL (200,000 copies/µL) in IDTE pH 8.0. Shipped at ambient temperature.
Cat# Product Name Korea List Price Sequence
2019-nCov CDC EUA Kit, 1000 rxn 347,000
10006896 2019-nCoV_E Positive Control 108,000 2019-nCoV_RdRp (ORF1ab) control: Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome (GenBank: NC_045512.2) 
10006897 2019-nCoV_RdRp (ORF1ab) Positive Control 108,000 2019-nCoV_E control: Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome (GenBank: NC_045512.2)
10006804 E Assay_First Line Screening, 1,000 Rxns 852,000
10006889 E_Sarbeco_F1 Forward Primer, 100 nmol 318,000 ACAGGTACGTTAATAGTTAATAGCGT
10006892 E_Sarbeco_P1 Probe, 25 nmol 397,000 ACACTAGCCATCCTTACTGCGCTTCG
10006891 E_Sarbeco_R2 Reverse Primer, 100 nmol 318,000  ATATTGCAGCAGTACGCACACA
10006890 E_Sarbeco_R2 Reverse Primer, 50 nmol 217,000  ATATTGCAGCAGTACGCACACA
10006830 nCOV_N1 Forward Primer Aliquot, 100 nmol 318,000 GACCCCAAAATCAGCGAAAT
10006821 nCOV_N1 Forward Primer Aliquot, 50 nmol 217,000 GACCCCAAAATCAGCGAAAT
10006823 nCOV_N1 Probe Aliquot, 25 nmol 397,000 ACCCCGCATTACGTTTGGTGGACC
10006832 nCOV_N1 Probe Aliquot, 50 nmol 599,000 ACCCCGCATTACGTTTGGTGGACC
10006831 nCOV_N1 Reverse Primer Aliquot, 100 nmol 318,000 TCTGGTTACTGCCAGTTGAATCTG
10006822 nCOV_N1 Reverse Primer Aliquot, 50 nmol 217,000 TCTGGTTACTGCCAGTTGAATCTG
10006833 nCOV_N2 Forward Primer Aliquot, 100 nmol 318,000 TTACAAACATTGGCCGCAAA
10006824 nCOV_N2 Forward Primer Aliquot, 50 nmol 217,000 TTACAAACATTGGCCGCAAA
10006826 nCOV_N2 Probe Aliquot, 25 nmol 397,000 ACAATTTGCCCCCAGCGCTTCAG
10006835 nCOV_N2 Probe Aliquot, 50 nmol 599,000 ACAATTTGCCCCCAGCGCTTCAG
10006834 nCOV_N2 Reverse Primer Aliquot, 100 nmol 318,000 GCGCGACATTCCGAAGAA
10006825 nCOV_N2 Reverse Primer Aliquot, 50 nmol 217,000 GCGCGACATTCCGAAGAA
10006815 nCOV_N3 Forward Primer Aliquot, 100 nmol 318,000 GGGAGCCTTGAATACACCAAAA
10006813 nCOV_N3 Forward Primer Aliquot, 50 nmol 217,000 GGGAGCCTTGAATACACCAAAA
10006816 nCOV_N3 Reverse Primer Aliquot, 100 nmol 318,000 TGTAGCACGATTGCAGCATTG
10006814 nCOV_N3 Reverse Primer Aliquot, 50 nmol 217,000 TGTAGCACGATTGCAGCATTG
10006805 RdRp Assay_Confirmatory, 1,000 Rxns 852,000
10006806 RdRP Assay_Discriminatory, 1,000 Rxns 852,000
10006882 RdRP_SARSr_F2 Forward Primer, 100 nmol  318,000  GTGARATGGTCATGTGTGGCGG
10006860 RdRP_SARSr_F2 Forward Primer, 50 nmol 217,000  GTGARATGGTCATGTGTGGCGG
10006884 RdRP_SARSr_P1 Probe, 25 nmol 397,000 CCAGGTGGWACRTCATCMGGTGATGC
10006885 RdRP_SARSr_P1 Probe, 50 nmol 599,000 CCAGGTGGWACRTCATCMGGTGATGC
10006886 RdRP_SARSr_P2 Probe, 25 nmol 397,000  CAGGTGGAACCTCATCAGGAGATGC
10006887 RdRP_SARSr_P2 Probe, 50 nmol 599,000  CAGGTGGAACCTCATCAGGAGATGC
10006883 RdRP_SARSr_R1 Reverse Primer, 100 nmol 318,000  CARATGTTAAASACACTATTAGCATA
10006881 RdRP_SARSr_R1 Reverse Primer, 50 nmol 217,000  CARATGTTAAASACACTATTAGCATA
10006836 RNase P Forward Primer Aliquot, 100 nmol 318,000 AGATTTGGACCTGCGAGCG
10006827 RNase P Forward Primer Aliquot, 50 nmol 217,000 AGATTTGGACCTGCGAGCG
10006837 RNase P Reverse Primer Aliquot, 100 nmol 318,000 GAGCGGCTGTCTCCACAAGT
10006828 RNase P Reverse Primer Aliquot, 50 nmol 217,000 GAGCGGCTGTCTCCACAAGT
10006829 RNase P Probe Aliquot, 25 nmol 397,000 TTCTGACCTGAAGGCTCTGCGCG
10006838 RNase P Probe Aliquot, 50 nmol 599,000 TTCTGACCTGAAGGCTCTGCGCG
10006888 E_Sarbeco_F1 Forward Primer, 50 nmol 217,000
10006893 E_Sarbeco_P1 Probe, 50 nmol 599,000 ACACTAGCCATCCTTACTGCGCTTCG

Probe FAM/ZEN/IBFQ Դϴ.

10006625 2019-nCoV_N_Positive Control  117,000  
10006626 Hs_RPP30 Positive Control  93,600  
10006713 2019-nCOV RUO Kit, 500 rxn 154,440

 

Control plasmid Map ÷ ZIP Ͽ Ȯ Ͻ ֽϴ.
2019-nCoV CDC Assays :  https://sg.idtdna.com/pages/landing/coronavirus-research-reagents/cdc-assays

2019-nCoV Charit&eacute;/Berlin Primer Probe Panel : https://sg.idtdna.com/pages/landing/coronavirus-research-reagents/who-assays

gototop